Genetic Variation of Taste Receptors

نویسنده

  • Arthur L. Fox
چکیده

The people have different behaviour to choose the food, and there are many factors that affect the food choices. The best significant factor to choose the food is taste. Differences in taste perception of several taste modalities are associated to difference in the taste receptors. Polymorphisms of the genes that encoding these taste receptors may clarify this unpredictability in taste perception. Individual changes in the capability to identify bitter tasting compounds, such as phenylthiocarbamide (PTC) were a well-known example of this variability. This difference divided the people in two groups: tasters and non-tasters, and is because of in part to single nucleotide polymorphisms (SNP) of a bitter taste receptor gene, taste receptor, type 2 (TAS2R) 38. The experiment was designed to determine the PTC phenotype and genotype, the SNP at position 785 is of particular importance in genotyping. DNA was extracted from check cell by using Chelex technique and genotyped by using polymerase chain reaction (PCR) followed by restriction fragments length polymorphism (PCR-RFLP). A 2% of Agarose gel electrophoresed and stained with Ethidium Bromide to imagine the genotype pattern. The class was tasted PTC test paper to compare phenotype and genotype. The total was 108 students the genotype showed 21 taster (+/+), 51 was mild taster (+/-) and 36 was nontaster (-/-).The allele frequency was not statistically significantly differ from European population. Therefore, TAS2R38 genotype is a truer estimation of the extent of the influence of this single gene on taste perception of PTC in a genetically diverse population. Introduction: Taste perception is the most sensitive predictor of how much a food is pleasant and unpleasant. The people are different in the taste perception of sweet, bitter, sour, or salty tastes which could influence the dietary behaviour (2, 3, 4). The variations in the taste perception between the individuals may relate to a variation in the gene taste receptors (2). The gene family of the taste receptors are encoding from TAS1R and TAS2R. The bitter taste receptors are include the TAS2R38 and TAS2R550. While the umami and sweet taste receptors is the TAS1R. The sour taste receptors are the PKDIL3 and PKD2L1. The genetic variation in these receptors may causes to deferential favourites for some types of food. Phenylthiocarbamide (PTC) compounds is the example was more studied in the variation of the sensitivity of taste as the bitterness (2, 5). The TAS2R38 gene is one of the most studied from over twenty-five in bitter taste receptor gene (4).The TAS2R38 gene is responsible for the taste perception of PTC as more bitter and the other related compounds like 6-n-propylthiouracil (PROP) which both contain a group of thiourea (7.8). The variation in the gene TAS2R38 divided the individuals in two groups of thiourea tasters: tasters and non-tasters (4, 5). Phenylthiocarbamide (PTC) The variation in the taste perception of PTC rely on the genetic studies. In 1930s, difference in the ability to taste PTC was first finding by Arthur L. Fox in a laboratory accidental (6). When he was working in the laboratory and transferring PTC powder into a bottle. Some particles of PTC powder flew into the air and his colleague close to him C. R. Noller tasted the particles as bitter but Fox tasted nothing. Fox was make experiment to test a large number of individuals and he found the difference in their ability to taste PTC and he divided the people in two main groups’ tasters and non-tasters (1). Worldwide about 25% of population classified as ‘non-tasters’ and the remaining 75% as ‘tasters’ (1). In addition, Bartoshuk et al, in 1992, discovered that the ‘tasters’ varied in the perception of PTC/PROP in a bi-modal fashion, and they separated them into medium tasters and supertasters. The supertasters were very sensitive to PTC, perceiving them as more bitter, while the medium tasters may taste PTC and found it mild bitter. Besides, the spread of super, medium and non-tasters in the general population is roughly 25%, 50% and 25%, respectively (1). The PTC sensitivity believed to be inherited as a simple Mendelian trait with two alleles a dominant trait (T) for taster and recessive trait (t) for non-taster (9). Figure 1: shows the inheritance of PTC trait. PTC genotype TAS2R38 or PTC gene is located on chromosome 7q and consists of a single coding exon 1002 bp long, encoding 333 amino acids, 7-transmembrane domain G-protein-coupled receptor (2, 6). A number of SNPs have been identified within this gene, the three most common SNPs (>1% of the population has variants at a specific DNA sequence, considered an SNP and <1% considered as mutation) change at 3 amino acids positions: 49, 262, and 296 forming numerous haplotypes. PAV (proline49, alanine262 & valine296) taster form and AVI (alanine49, valine262 & isoleucin296) non-taster form are the two most common (4).Also, the PAV/PAV homozygotes are sensitive to PTC more than PAV/AVI heterozygotes while AVI/AVI homozygotes are fewer sensitive (4). The AVI haplotypes in the non-tester differ at 3 SNPs from the PAV haplotypes of the tasters (9). The aim of this practical: To focus on the TAS2R38 genotype and its link with the ability to taste PTC test paper. The SNP at position 785 is of specific concern in genotyping. Comparing the allele frequency detected in the class with those observed in European population subject in group 226 and Sub-Saharan African subject in group 224. Material and Methods: To determine the TAS2R38 (A262V) genotype by using the polymerase chain reaction (PCR) and restriction endonuclease digestion, Fnu4H1 enzyme. The procedure that has been done was as the following: 1. Protocol of DNA Extraction from Cheek Cell (scrape or wash): First week take a 10 ml of water pour into mouth and swirl to release buccal cells and spit back contents into tube. Centrifuge the tube at 3000rpm for 3 minutes, carefully pour off supernatant and retain cell pellet. Added 350μl of 5% Chelex mix and then transfer the pelleted buccal cells to new (1.5ml) Eppendorf tube. The 5% Chelex to protects DNA breakdown under a high temperature. Added 4μl of proteinase K to the Eppendorf tube that contains buccal cells and 5% Chelex. Incubated the tube containing chelex/cells at 56°C for 30 minutes in the heating block, then briefly vortex the tube for 10 seconds after that centrifuge the tube at 3000rpm for 20 seconds. Incubated the tube ( chelex/cells) again in heating block at 98°C for 15 minutes, then vortex the tube for 10 seconds, after that centrifuge for 3minutes.Transferred the supernatant that above the chelex containing the buccal cell (DNA template) into the sterile 1.5ml Eppendorf tube and measured the DNA concentration by take 1μl of DNA into machine called nanodrop nucleic acid then kept at -20°C to preserve the DNA. 2. Protocol of Phenyl Thiocarbanate(PTC) using PCR Reaction: Second week take a 43.5μl of master mix was already prepared in the PCR tube and transferred 6.5μl of DNA extraction. (Buccal cell DNA).Vortex and spin the tube to make the liquid contents to bottom of the tube. The total PCR tube reaction volume contain 50μl of mixtures were placed in the PCR machine and the thermal cycler conditions were: cycle of 94°C for 4 minutes. The 40 cycles of 55°C for 40 seconds, 72°C for 40 seconds and 94°C for 40 seconds .Then 1 cycle of 55°C for 5 minutes and at 72°C for 5 minutes. The sequence of Forward primer was 5’ AACTGGCAGAATAAAGATCTCAATTTAT3’ The sequence of the Reverse primer was 5’ AACACAAACCATCACCCCTATTTT 3’. 3. Restriction Digestion (Fnu4HI): Last week transferred a 20 μl of the component mixture (PCR product) to a tube containing 10μl of the restriction endonuclease master. The tube was placed in into a 37°C heating block for two hours. 4. Electrophoresis of PCR Products: A 30ml of 2% Agarose gel with 0.5μl/ml of ethidium bromide was loaded into the gel tank with adjusting the comb, the gel was kept 15 minutes to get stuck. After that the TBE buffer was loaded, covering the surface of the gel and the comb was removed. Take 12μl of PCR product undigested and digested into two different tubes added 3μl of DNA loading buffer mix and spin. Then, 10μl of PCR product/loading buffer was loaded into the well of 2% Agarose gel and 10μl of the ladder (100bp) was added in the last well. The gel electrophoresed at 90 volt for 45minutes, negatively charged (-ve) DNA moved toward the anode side (red). Last take gel photograph under UV trans-illumination.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Genetic variation in taste and its influence on food selection.

Abstract Taste perception plays a key role in determining individual food preferences and dietary habits. Individual differences in bitter, sweet, umami, sour, or salty taste perception may influence dietary habits, affecting nutritional status and nutrition-related chronic disease risk. In addition to these traditional taste modalities there is growing evidence that "fat taste" may represent a...

متن کامل

Genetics of human taste perception.

Genetic approaches are rapidly yielding new information about our sense of taste. This information comes from both molecular studies of genes encoding taste receptors and other taste-signaling components, and from studies of inherited variation in taste abilities. Our understanding of bitter taste has advanced by combined information from discovery and study of the TAS2R family of taste recepto...

متن کامل

Multiple loss-of-function variants of taste receptors in modern humans

Despite recent advances in the knowledge of interindividual taste differences, the underlying genetic backgrounds have remained to be fully elucidated. Much of the taste variation among different mammalian species can be explained by pseudogenization of taste receptors. Here I investigated whether the most recent disruptions of taste receptor genes segregate with their intact forms in modern hu...

متن کامل

Taste Receptor Polymorphisms and Immune Response: A Review of Receptor Genotypic-Phenotypic Variations and Their Relevance to Chronic Rhinosinusitis

Bitter (T2R) and sweet taste (T1R) receptors have emerged as regulators of upper airway immune responses. Genetic variation of these taste receptors additionally confers susceptibility to infection and has been implicated in severity of disease in chronic rhinosinusitis (CRS). Ongoing taste receptor research has identified a variety of biologically active compounds that activate T1R and T2R rec...

متن کامل

GWAS of human bitter taste perception identifies new loci and reveals additional complexity of bitter taste genetics

Human perception of bitterness displays pronounced interindividual variation. This phenotypic variation is mirrored by equally pronounced genetic variation in the family of bitter taste receptor genes. To better understand the effects of common genetic variations on human bitter taste perception, we conducted a genome-wide association study on a discovery panel of 504 subjects and a validation ...

متن کامل

Variation in the human TAS1R taste receptor genes.

We have performed a comprehensive evaluation of single-nucleotide polymorphisms (SNPs) and haplotypes in the human TAS1R gene family, which encodes receptors for sweet and umami tastes. Complete DNA sequences of TAS1R1-, TAS1R2-, and TAS1R3-coding regions, obtained from 88 individuals of African, Asian, European, and Native American origin, revealed substantial coding and noncoding diversity: p...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:

دوره   شماره 

صفحات  -

تاریخ انتشار 2017